Table 2.

BLAST results for neuropeptide receptor primer design and primer sequences

Primer sequences
ReceptorAccession no. of sequence for forward BLAST and origin speciesReturned M. sexta subject sequence ID and E valueAccession no. of reverse BLAST top hitForwardReverseAnnealing temp. (°C)
TKrAAA28722.1 (D. melanogaster)Msex2.00568-RA scaffold00007:996602-1079056(+); JH668285.1; E value: e-103NP_001127749.1 (Bombyx mori) ACAGGTACGTGGCGATAGTG AGCTGGCACACCAAACAGTA58.3
FMRFrAHN57950.1 (D. melanogaster)Msex2.13475-RA scaffold01034:41471-49046(+); JH669301.1; E value: 2e-77NP_001037007.1 (Bombyx mori) ACCGTGCTCATCCTTACCTC TGCGGACACACGTGATAGTA58.3
ASTrAAG22404.3 (D. melanogaster)Msex2.08175-RB scaffold00218:172215-185483(–); JH668496.1; E value: e-100ACJ06649.1 (Spodoptera littoralis) ATCTGGCCGTAGCTGATCTT GCATTACATAAT CCGTTGCG58.3
MIPrNP_001108346.1 (Bombyx mori)Msex2.12746-RA scaffold00798:532-18804(+); JH669075.1; E value: e-139AGE92037.1 (Spodoptera litura) GGGTTCAGGGTACTGTTCGT GAACAGGAGCACATTCAGGA58.3
Mas-ATrADX66344.1 (M. sexta; Horodyski et al., 2011)JH668656.1N/A TTCCTTGGAGACGTGCTGT ACTTGAACTTGAGCGGG52
GABAB-R1HG004164.1 (Heliothis virescens; at European Nucleotide Archive)Msex2.03321-RA scaffold00068:510618-566612(–); JH668346.1; E value:
0.0
XM_013339859.1 (Amyelois transitella) TATTTCGGGAATGACTTCTG TCAATATCATATCCGGCTTC58.3
RPs3U12708 (M. sexta; Jiang et al., 1996)JH668297.1N/A CATGATCCACTCCGGTGAC GACCTTAATTCCGAGCACTCC58.3
vGLUTFBgn0031424 (D. melanogaster; at FlyBase)JH668481; E value: 5e-18XM_014627996.1 (Dinoponera quadriceps) GACCACGACTAATGTGCGGA CATTGAGTTGACGATCGGCG58.3