Table 1:

Primer sequences used for qRT-PCR

Gene nameForward primerReverse primer
18S5´CGAACGTCTGCCCTATCAACTT3´5’ACCCGTGGTCACCATGGTA3’
Myelin basic protein (Mbp)5´CCCGTGGAGCCGTGATC3´TCTTCAAACGAAAAGGGACGAA-3′
Glial fibrillary acidic protein (Gfap)5´CGTTTCTCCTTGTCTCGAATGA3´5´CCCGGCCAGGGAGAAGT3´
Inhibitor of DNA binding (Id4)5´TTTGCACGTTCACGAGCATT3´5´GCGGTCATAAAAGAAGAAACGAA3´
Myelin regulatory factor (Myrf)5′AAGGAGCTGCCTATGCTCACCT3′5′GCCTCTAGCTTCACACCATGCA3′
BMPRIA (Bmpr1a)5´TCATGTTCAAGGGCAGAATCTAGA3´5´GGCAAGGTATCCTCTGGTGCTA3´
BMPRIB (Bmpr1b)5´GCGCACCCCGATGTTG3´5´CATGTCCCCTAAGAAGCTTTCTG3´
BMPRIA-ex25´GTTCATCATTTCTCATGTTCAAACTA3´5´AATCAGAGCCTTCATACTTCATACACC3´